Unicamp 2018 - 2ª fase - Biologia, Física e Química - Questões com gabarito

tabela-unicamp-2018-provas-de-quimica-fisica-biologia
Unicamp 2018 - 2ª fase - Biologia, Física e Química - Questões com gabarito (clique na imagem para ampliar)
Unicamp 2018 - 2ª fase - Biologia, Física e Química - Questões com gabarito 

Unicamp 2018: Segunda Fase. Questão 01 - Biologia
Dados genéticos podem ser utilizados para estudar populações de uma espécie no ambiente natural.
Por exemplo, amostras de DNA podem ser coletadas para identificar espécies, estimar tamanhos
populacionais ou identificar indivíduos. Um pesquisador coletou duas amostras de fezes em uma localidade na Índia e sequenciou parte do gene Gapdh dos DNAs extraídos a partir delas. Como resultado, foram obtidas as sequências abaixo (apenas uma das fitas do DNA é mostrada).

Amostra 1 5' ACAGGATCCAATAACCCCGCAGGAATGGTG 3'
Amostra 2 5' ACAGGATCCAATAACCCCTCACGAATGGTG 3'

As sequências da mesma região do gene Gapdh nos genomas do tigre de Bengala (Panthera tigris) e do leopardo (Panthera pardus) são:

Panthera tigris 5' ACAGGATCCAATAACCCCGCAGGAATGGTG 3'
Panthera pardus 5' ACAGGATCTAACAACCCCGCAGGAATAGTA 3'

a) De posse desses dados, responda: as amostras de fezes 1 e 2 pertencem, com maior probabilidade, a tigres de Bengala ou a leopardos? As amostras 1 e 2 pertencem ao mesmo indivíduo ou a dois indivíduos diferentes? Justifique sua resposta.

b) Um crítico argumentou que o trabalho do pesquisador não era válido, pois as sequências do gene
nuclear Gapdh foram obtidas a partir de amostras de fezes. Segundo o crítico, material genético nuclear de felinos só poderia ser extraído com qualidade a partir de hemácias (eritrócitos) coletadas dos animais. Quem tem razão, o pesquisador ou o crítico? Justifique.
(Fonte: J. Bhagavatula e L. Singh. BMC Genetics, Londres, v. 7, p. 48, out. 2006.)


Unicamp 2018: Segunda Fase. Questão 02 - Biologia
A figura A abaixo mostra o claro dimorfismo sexual que ocorre na espécie de besouro neotropical Dynastes hercules (besouro-hércules), um dos maiores besouros do mundo. Nos machos, protuberâncias cefálicas e torácicas formam estruturas semelhantes aos chifres de alguns mamíferos. Um estudo mostrou que, nessa espécie, há três tipos de machos geneticamente distintos, P, M e G, que diferem apenas quanto ao tamanho médio dos "chifres" (figura B). Os dados na figura C indicam a capacidade de machos dos três tipos de copular com fêmeas. Testes genéticos mostraram ainda que 85% dos filhotes em cada geração têm machos do tipo G como pais.

unicamp-2018-a-figura-a-abaixo-mostra-o-claro-dimorfismo-sexual-que-ocorre-na-especie-de-besouro-neotropical-dynastes-hercules-besouro-hercules-um-dos-maiores-besouros-do-mundo

a) Os "chifres" são parte do esqueleto do besouro-hércules macho. Cite duas características do esqueleto de artrópodes e duas diferenças em relação ao esqueleto de vertebrados.

b) Darwin acreditava que diferenças entre animais machos e fêmeas como as mostradas na figura A surgem durante a evolução como consequência da seleção sexual, um tipo especial de seleção natural. Defina seleção natural. Utilizando os dados fornecidos acima, explique por que a característica masculina dimórfica do besouro-hércules é uma adaptação, fruto da seleção natural.


Unicamp 2018: Segunda Fase. Questão 03 - Biologia
As questões a seguir tratam de alimentação e saúde humana.

a) Um dos maiores problemas de saúde pública no mundo é a obesidade. Considerando separadamente as populações masculina e feminina, em qual faixa etária houve maior crescimento proporcional de obesos entre 1975 e 2009, de acordo com os gráficos abaixo? Sabendo que os carboidratos constituem aproximadamente 50% da dieta diária recomendada pelo Ministério da Saúde, explique a necessidade desse nutriente e por que ele pode causar obesidade.

unicamp-2018-as-questoes-a-seguir-tratam-de-alimentacao-e-saude-humana

b) O consumo diário de frutas, hortaliças e legumes é considerado altamente benéfico para a saúde humana. Um estudo realizado no Hospital do Câncer de Barretos (SP) indicou que as hortaliças da família das crucíferas (brócolis, couve-flor, couve, agrião, rúcula, entre outras), após passarem por processamento enzimático no organismo, liberam sulforafano e indol-3-carbinol, substâncias capazes de inibir a proliferação celular. O que é o câncer? Por que as hortaliças da família das crucíferas são consideradas importantes na prevenção dessa doença?
(Fonte: Pesquisa de orçamentos familiares, Instituto Brasileiro de Geografia e Estatística - IBGE. Disponível em www.ibge.gov.br/estatisticas-novoportal. Acessado em 15/10/2017.)


Unicamp 2018: Segunda Fase. Questão 04 - Biologia
Plantas têm papel crucial na ciclagem de carbono e de água no ambiente, captando e liberando o gás carbônico atmosférico e transferindo água do solo para o ar. Os gráficos abaixo representam padrões anuais de variação nas concentrações de vapor d’água do ar e de gás carbônico em regiões ocupadas por duas florestas tropicais distintas, A e B.

unicamp-2018-plantas-tem-papel-crucial-na-ciclagem-de-carbono-e-de-agua-no-ambiente-captando-e-liberando-o-gas

As variações mostradas ocorrem como consequência da presença das florestas. A precipitação nas duas áreas ocorre no período quente do ano (setembro a abril). Além disso, a concentração de CO2 atmosférico seria de 380 ppm se não houvesse cobertura vegetal.

a) Considerando que a transpiração tem relação direta com o consumo hídrico, qual das duas florestas tem maior dependência de disponibilidade de água? Considerando que a fotossíntese e a respiração determinam o padrão anual de variação de CO2, qual das duas florestas tem maior produção anual de biomassa? Justifique suas respostas.

b) Em um cenário de redução no regime de chuvas, o que aconteceria com as concentrações de vapor d’água do ar e de CO2 nas regiões ocupadas pelas florestas? Justifique sua resposta.

Resposta.

Unicamp 2018: Segunda Fase. Questão 05 - Biologia
A estrutura química do composto puromicina é muito semelhante à estrutura de um RNA transportador. Em virtude dessa semelhança, os ribossomos de procariotos são capazes de interagir com a puromicina como se ela fosse um RNA transportador. O ribossomo catalisa a formação de uma ligação covalente entre a cadeia proteica em crescimento e a puromicina, se este composto estiver presente durante a tradução. Após tal evento bioquímico, novos aminoácidos não podem ser incorporados à cadeia da proteína.

a) Por que a puromicina tem ação antibiótica sobre bactérias? Na presença de puromicina, a massa molecular média de uma dada proteína bacteriana será maior, igual ou menor em relação à massa média da mesma proteína na ausência do antibiótico? Explique seu raciocínio.


b) A puromicina também é utilizada para transgenia. Neste caso, um gene que codifica uma enzima capaz de destruir a puromicina é adicionado, juntamente com o gene de interesse do pesquisador, ao genoma de células cultivadas in vitro. Na presença de puromicina, a taxa de sobrevivência de células que receberam esses genes será igual, maior ou menor em relação à sobrevivência de células não modificadas? Explique seu raciocínio.

Resposta.

Unicamp 2018: Segunda Fase. Questão 06 - Biologia
O heredograma abaixo representa o padrão de herança, em uma única família, de uma doença genética humana. Os indivíduos doentes são representados em preto, enquanto os indivíduos não doentes são indicados em branco. Nessa família, a doença é causada por apenas um loco gênico, localizado em um dos dois tipos de cromossomos sexuais. No conjunto dos indivíduos da família, esse loco apresenta dois alelos, A1 e A2.

a) O loco gênico envolvido nessa doença está no cromossomo X ou no cromossomo Y? Considerando que um dos alelos é dominante, o alelo que promove o aparecimento da doença nos indivíduos afetados (alelo A1) é dominante ou recessivo em relação ao alelo A2? Explique como você chegou às suas conclusões.

b) Pesquisas recentes analisaram as alterações causadas nos neurônios de indivíduos doentes pelo alelo A1. Nessas pesquisas, fibroblastos coletados da pele de pessoas afetadas foram utilizados para produzir células-tronco pluripotentes (iPSC). As iPSC foram então utilizadas para gerar neurônios. Por que células-tronco podem originar neurônios? Por que não seria adequado aos pesquisadores estudar os efeitos neuronais do alelo A1 diretamente nos fibroblastos coletados da pele dos indivíduos afetados?

(Inspirado em Maria C. N. Marchetto e outros, A model for neural development and treatment of Rett Syndrome using human induced pluripotent stem cells. Cell, Cambridge, v. 143, p. 527–539, nov. 2010. Pesquisa realizada pela equipe do brasileiro Alysson Muotri, ex-aluno da UNICAMP e atualmente professor da Universidade da Califórnia, San Diego, EUA.)


Unicamp 2018: Segunda Fase. Questão 07 - Física

Esteiras rolantes horizontais são frequentemente instaladas em grandes aeroportos para facilitar o deslocamento das pessoas em longos corredores...

unicamp-2018-esteiras-rolantes-horizontais-sao-frequentemente-instaladas-em-grandes

a) Calcule o tempo necessário para que a pessoa A chegue até a outra extremidade da esteira rolante.

b) Quanto tempo depois de entrarem nas esteiras as pessoas A e B passam uma pela outra?

Resposta.

Unicamp 2018: Segunda Fase. Questão 08 - Física
Um gigantesco iceberg desprendeu-se recentemente da Antártida, no extremo sul do planeta. O desprendimento desse iceberg, batizado de A68, foi considerado um dos maiores eventos do gênero já registrados pela ciência moderna. Segundo a NASA, é difícil prever se o iceberg permanecerá como um único bloco, mas é mais provável que ele se fragmente.

unicamp-2018-um-gigantesco-iceberg-desprendeu-se-recentemente-da-antartida-no-extremo-sul-do-planeta

Unicamp 2018: Segunda Fase. Questão 09 - Física
Importantes estudos sobre o atrito foram feitos por Leonardo da Vinci (1452-1519) e por Guillaume Amontons (1663-1705). A figura (a) é uma ilustração feita por Leonardo da Vinci do estudo sobre a influência da área de contato na força de atrito.

unicamp-2018-segunda-fase-questao-09-fisica-figura-a
a) Dois blocos de massas m1 = 1,0 kg e m2 = 0,5 kg são ligados por uma corda e dispostos como mostra a figura (b). A polia e a corda têm massas desprezíveis, e o atrito nas polias também deve ser desconsiderado. O coeficiente de atrito cinético entre o bloco de massa m2 e a superfície da mesa é µc = 0,8. Qual deve ser a distância de deslocamento do conjunto para que os blocos, que partiram do repouso, atinjam a velocidade v = 2,0 m/s?

unicamp-2018-segunda-fase-questao-09-fisica-figura-b
b) Em certos casos, a lei de Amontons da proporcionalidade entre a força de atrito cinético e a força normal continua válida nas escalas micrométrica e nanométrica. A figura (c) mostra um gráfico do módulo da força de atrito cinético, Fat, em função do módulo da força normal, N, entre duas monocamadas moleculares de certa substância, depositadas em substratos de vidro. Considerando N = 5,0 nN, qual será o módulo do trabalho da força de atrito se uma das monocamadas se deslocar de uma distância d = 2,0 µm sobre a outra que se mantém fixa?

Resposta.

Unicamp 2018: Segunda Fase. Questão 10 - Física

Termômetros clínicos convencionais, de uso doméstico, normalmente baseiam-se na expansão térmica de uma coluna de mercúrio ou de álcool, ao qual se adiciona um corante. Com a expansão, o líquido ocupa uma parte maior de uma coluna graduada, na qual se lê a temperatura.
unicamp-2018-segunda-fase-questao-10-fisica-figura-questoes-a-e-b
Considerar:
considerar-questao-10-unicamp-2018
Resposta.

Unicamp 2018: Segunda Fase. Questão 11 - Física

Geradores de Van de Graaff têm a finalidade de produzir altas diferenças de potencial. Consistem em uma esfera metálica onde é acumulada a carga proveniente de uma correia em movimento...

unicamp-2018-segunda-fase-questao-11-fisica

Resposta.

Unicamp 2018: Segunda Fase. Questão 12 - Física
unicamp-2018-segunda-fase-questao-12-fisica-figura
A acomodação da visão consiste na mudança da distância focal do cristalino, que é uma lente convergente do olho, de modo que a imagem se forme exatamente na retina, tanto para objetos a grandes distâncias quanto para objetos próximos. A catarata é uma doença que torna o cristalino opaco. Seu tratamento consiste na substituição do cristalino doente por uma lente intraocular. Neste caso, a acomodação visual pode ser obtida através do deslocamento da lente implantada, para frente e para trás, com o auxílio do músculo ciliar.

a) Uma lente de distância focal fixa forma a imagem de um objeto localizado a uma grande distância em um anteparo, conforme mostra a figura (a). Qual é a distância focal da lente, e quanto ela deve ser afastada para formar, no anteparo, a imagem de um objeto localizado a 50 cm da posição final da lente, conforme mostra a figura (b)?

unicamp-2018-segunda-fase-questao-12-fisica

Resposta.

Unicamp 2018: Segunda Fase. Questão 13 - Química
O Brasil é o maior produtor não asiático de arroz. Em 2015, importou cerca de 370 mil toneladas do produto e exportou 960 mil. Esse cereal é uma importante fonte de nutrientes para bilhões de pessoas, fornecendo 15% das necessidades diárias de proteína de um adulto. O arroz é também importante fonte de minerais como cálcio, fósforo, potássio e, em menor quantidade, ferro, manganês e zinco. Dependendo de alguns fatores, como o local de produção ou o uso de fertilizantes e defensivos agrícolas, o arroz pode conter pequenas quantidades de arsênio, cádmio, chumbo, entre outros elementos.

a) Um estudo comparou três modos diferentes de cozinhar o arroz para verificar como a forma de preparo pode modificar a quantidade de minerais no cereal cozido.

1. O arroz foi cozido na proporção de cinco partes de água para uma parte de arroz. O excesso de água foi drenado após o cozimento.
2. O arroz foi embebido em água durante a noite, a água foi drenada e o arroz foi lavado até a água clarear. Drenou-se a água, e o arroz foi cozido na proporção de cinco partes de água para uma parte de arroz. O excesso de água foi drenado após o cozimento.
3. O arroz foi cozido na proporção de duas partes de água para uma de arroz. O excesso de água evaporou durante o processo de cozimento.

Do ponto de vista químico, qual tipo de cozimento deve ter levado à menor presença de minerais no arroz cozido: 1, 2 ou 3? Justifique sua resposta.

b) Em outro estudo, determinaram-se as concentrações totais de arsênio, cádmio e chumbo, em diferentes tipos comerciais de arroz (polido, integral e parboilizado) provenientes de várias regiões brasileiras, visando à promoção da saúde pública. Explique de que forma esse estudo estaria promovendo a saúde pública ao se preocupar com a presença desses elementos químicos e suas concentrações em diferentes tipos comerciais de arroz.

Resposta.

Unicamp 2018: Segunda Fase. Questão 14 - Química

Uma das formas de se prevenir a transmissão do vírus H1N1, causador da gripe suína, é usar álcool 70% para higienizar as mãos. É comum observar pessoas portando álcool gel na bolsa ou encontrá-lo em ambientes públicos, como restaurantes, consultórios médicos e hospitais. O álcool 70% também possui ação germicida contra diversas bactérias patogênicas. A tabela abaixo mostra a ação germicida de misturas álcool/água em diferentes proporções contra o Streptococcus pyogenes, em função do tempo de contato.

a) Recomenda-se descartar uma garrafa com álcool 70% deixada aberta por um longo período, mesmo que ela esteja dentro do prazo de validade. Justifique essa recomendação levando em conta os dados da tabela ao lado e considerando o que pode acontecer à solução, do ponto de vista químico.

b) Além da higienização com álcool 70%, também estamos acostumados a utilizar água e sabão. Ambos os procedimentos apresentam vantagens e desvantagens. As desvantagens seriam a desidratação ou a remoção de gorduras protetoras da pele. Correlacione cada procedimento de higienização com as desvantagens citadas. Explique a sua resposta explicitando as possíveis interações químicas envolvidas em cada caso.

Resposta.

Unicamp 2018: Segunda Fase. Questão 15 - Química
Apesar de ser um combustível alternativo em relação aos combustíveis fósseis, o gás hidrogênio apresenta alguns problemas em seu uso direto. Uma alternativa é produzir o gás hidrogênio por eletrólise da água, para depois utilizá-lo na síntese do ácido fórmico, a partir da hidrogenação catalítica de gás carbônico. A possibilidade de utilizar o ácido fórmico como combustível tem feito crescer a demanda mundial por esse produto. A figura abaixo ilustra como seria o ciclo de produção e consumo do ácido fórmico, conforme indica o texto.

unicamp-2018-apesar-de-ser-um-combustivel-alternativo-em-relacao-aos-combustiveis-fosseis
a) Considerando as informações do texto e a figura ao lado, cite duas vantagens em se adotar a alternativa descrita.

b) A reação de síntese do ácido fórmico a partir da hidrogenação catalítica de gás carbônico, em fase gasosa, apresenta um valor muito pequeno de constante de equilíbrio. Visando a aumentar o seu rendimento, imagine que sejam promovidos, separadamente, um aumento do volume e um aumento da temperatura da mistura reacional em equilíbrio. Preencha a tabela abaixo de modo a informar o que ocorre com a quantidade de ácido fórmico. Use as palavras aumenta ou diminui e justifique cada escolha no espaço correspondente.

Na temperatura da síntese, considere que as entalpias de formação do gás carbônico, do ácido fórmico e do hidrogênio são (em kJ∙mol-1) -394, -363 e 0, respectivamente.

Tabela para resposta da letra B:

unicamp-2018-segunda-fase-questao-15-quimica-resposta

Resposta.

Unicamp 2018: Segunda Fase. Questão 16 - Química
Graças a sua alta conversão energética e à baixa geração de resíduos, o gás hidrogênio é considerado um excelente combustível. Sua obtenção a partir da fermentação anaeróbia de biomassas, como bagaço de cana, glicerol, madeira e resíduos do processamento da mandioca, abundantes e de baixo custo, parece ser uma boa alternativa tecnológica para o Brasil. A velocidade da fermentação, bem como os diferentes produtos formados e suas respectivas quantidades, dependem principalmente do tipo de substrato e do tipo de microrganismo que promove a fermentação. As equações e a figura abaixo ilustram aspectos de uma fermentação de 1 litro de solução de glicose efetuada pela bactéria Clostridium butyricum.
unicamp-2018-segunda-fase-questao-16-quimica-1
a) Levando em conta as informações presentes no texto e na figura, e considerando que a fermentação tenha ocorrido, concomitantemente, pelas duas reações indicadas, qual ácido estava presente em maior concentração (mol∙L-1) ao final da fermentação, o butanoico ou o etanoico? Justifique sua resposta.

b) A velocidade instantânea da fermentação, em qualquer ponto do processo, é dada pela relação entre a variação da quantidade de hidrogênio formado e a variação do tempo. De acordo com o gráfico, quanto tempo após o início da fermentação a velocidade atingiu seu valor máximo? Justifique sua resposta.

Dados: massa molar da glicose: 180 g∙mol-¹; volume molar do hidrogênio: 25 L∙mol-¹.

Resposta.

Unicamp 2018: Segunda Fase. Questão 17 - Química
Fertilizantes são empregados na agricultura para melhorar a produtividade agrícola e atender à demanda crescente por alimentos, decorrente do aumento populacional. Porém, o uso de fertilizantes leva a alterações nas características do solo, que passa a necessitar de correções constantes. No Brasil, o nitrogênio é adicionado ao solo principalmente na forma de ureia, (NH2)2CO, um fertilizante sólido que, em condições ambiente, apresenta um cheiro muito forte, semelhante ao da urina humana. No solo, a ureia se dissolve e reage com a água conforme a equação
unicamp-2018-segunda-fase-questao-17-quimica
Parte do nitrogênio, na forma de íon amônio, se transforma em amônia, conforme a equação
unicamp-2018-segunda-fase-questao-17-quimica-1
Parte do nitrogênio permanece no solo, sendo absorvido através do ciclo do nitrogênio.

a) Na primeira semana após adubação, o solo, nas proximidades dos grânulos de ureia, torna-se mais básico. Considerando que isso se deve essencialmente à solubilização inicial da ureia e à sua reação com a água, explique como as características dos produtos formados explicam esse resultado.

b) Na aplicação da ureia como fertilizante, ocorrem muitos processos que levam à perda e ao não aproveitamento do nitrogênio pelas plantas. Considerando as informações dadas, explique a influência da acidez do solo e da temperatura ambiente na perda do nitrogênio na fertilização por ureia.

Resposta.

Unicamp 2018: Segunda Fase. Questão 18 - Química
A derrubada de florestas para mineração causa indignação em muitos cidadãos preocupados com a proteção ambiental. Contudo, não se observa o mesmo nível de preocupação em relação à atividade pecuária. A produção de carne é também responsável pelo desmatamento e por cerca de 18% da emissão de gases do efeito estufa. A evolução da emissão total de gás carbônico equivalente da humanidade (em Gt CO2 eq por ano) é mostrada na figura A. Já a figura B mostra a emissão anual média de gás carbônico equivalente (em t CO2 eq por pessoa por ano) somente com a alimentação, para duas diferentes dietas.

a) Considerando que toda a população mundial seja “amante de carne”, qual é a porcentagem de emissão de CO2 equivalente devida somente à alimentação, em relação à emissão total? Mostre os cálculos.

b) Se, em 2018, toda a população da Terra resolvesse adotar uma dieta vegana, a emissão total de gases voltaria ao nível de qual ano? Justifique sua resposta. Considere que toda a população atual seja “amante de carne”. Dados: a população mundial atual é de 7,6x10⁹ habitantes; Giga-toneladas (Gt) = 1,0x10⁹ toneladas.

Resposta.

Unicamp 2018 - 2ª fase - Biologia, Física e Química - Questões com gabarito Unicamp 2018 - 2ª fase - Biologia, Física e Química - Questões com gabarito Reviewed by Redação on fevereiro 06, 2018 Rating: 5

Nenhum comentário:

Tecnologia do Blogger.