Prova UNICAMP 2019 (2ª fase - 3° dia) com Gabarito e Resolução

Prova UNICAMP 2019 (2ª fase - 3° dia) com Gabarito e Resolução

Clique na imagem para ampliar

Química

QUESTÃO 01
(UNICAMP 2019) A fermentação de alimentos ricos em açúcares é um processo prejudicial à saúde bucal, pois promove um ataque químico ao esmalte dos dentes. A parte inorgânica dos dentes é formada por uma substância chamada hidroxiapatita, que, em um ambiente bucal saudável, apresenta baixa solubilidade. Essa solubilidade pode ser equacionada da seguinte forma:

Ca5(PO4)3OH(s) + aq = 5Ca²⁺(aq) + 3PO4³⁺(aq) + OHˉ(aq); Kps = 1,8x10ˉ⁵⁸.


a) Algumas características da saliva se alteram na presença de alimentos. Considerando que o prejuízo aos dentes causado pela ingestão de diferentes fontes de açúcar obedece à ordem cana > frutas > mel, preencha com as palavras cana, frutas e mel a tabela do espaço de respostas e explique em que se baseou a sua escolha.


b) O uso de água fluoretada e de produtos com flúor é recomendado para a saúde bucal. Explique a vantagem do uso do fluoreto levando em conta a equação informada acima e a equação de dissolução da fluoroapatita abaixo; indique também possíveis correlações entre essas equações.

Ca5(PO4)3F(s) + aq = 5Ca²⁺(aq) + 3PO4³ˉ(aq) + Fˉ(aq); Kps = 8x10ˉ⁶⁰

GABARITO.

QUESTÃO 02
(UNICAMP 2019) A pesquisa em alimentos está sempre à procura de novos produtos, ou novas formulações para antigos produtos, tanto para melhorar sua qualidade quanto para ampliar as opções do consumidor.

Um estudo recente, realizado pela Faculdade de Engenharia de Alimentos da UNICAMP, avaliou a preparação de mortadela com diferentes formulações (F). Alguns resultados desse trabalho são apresentados na tabela abaixo.


Dados:
F1: 2% de NaCl; controle.
F2: 1% de NaCl, 0,5% de KCl e 0,5% de CaCl2-.
F3: 1% de NaCl.
UFC: unidades formadoras de colônias (tomar como sinônimo de quantidade de microrganismos).

a) Considerando os resultados apresentados e seus conhecimentos, cite e comente dois objetivos possíveis desse estudo com relação ao NaCl.

b) Indique uma conclusão que se pode extrair desse estudo. Escolha e compare duas formulações para justificar sua resposta.

GABARITO.

QUESTÃO 03
(UNICAMP 2019) O bioplástico PLA (poliácido lático) é obtido pela polimerização do ácido lático (C5H10O3), um insumo que geralmente se origina da fermentação de açúcares provenientes do milho ou da cana-de-açúcar. Esse bioplástico é fabricado em larga escala em plantas industriais que funcionam à base de óleo cru, carvão ou gás natural.

O PLA já é hoje uma realidade comercial, logo é importante que ele seja claramente identificado na embalagem para facilitar a sua distinção entre outros plásticos. Ao ser descartado em ambientes com muito oxigênio e na presença de microrganismos, esse bioplástico é rapidamente oxidado a gás carbônico e água. Contudo, em ambientes com pouco oxigênio, como aterros sanitários, o PLA se decompõe muito lentamente ao reagir com a umidade, formando gás carbônico e metano.

a) Levando em conta as informações do texto, cite e comente uma desvantagem da produção do PLA e escreva a equação química para a formação do dímero desse ácido, sabendo que ele é obtido por uma condensação (com a liberação de água).


b) Levando em conta as informações do texto, cite e comente uma desvantagem do pós-consumo do PLA e escreva a equação química para uma das formas de decomposição do dímero do ácido lático.


GABARITO.

QUESTÃO 04
(UNICAMP 2019) Em um estudo recente, que avaliou a toxicidade em células humanas de pesticidas eficazes no combate a pragas, comenta-se: “pesticidas são usados no mundo todo como misturas denominadas formulações.

Essas misturas contêm adjuvantes, frequentemente mantidos como confidenciais e chamados de inertes pela indústria produtora. As formulações também incluem um princípio ativo, que é frequentemente testado sozinho.” A figura a seguir mostra parte dos resultados obtidos no referido estudo.


a) Considerando as informações dadas, indique em qual condição experimental as células humanas foram mais afetadas. Justifique sua resposta com base nos gráficos.

b) O parágrafo 11 do artigo 3º do PL Nº 6.299, de 2002 (conhecido como “Lei do Veneno”), estabelece: “As condições a serem observadas para a autorização de uso de pesticidas de controle ambiental e afins deverão considerar os limites máximos de resíduos estabelecidos nas monografias de ingrediente ativo publicadas pelo órgão federal de saúde.” Pensando na saúde humana, que recomendação técnica você daria a um deputado que fosse votar essa lei, especificamente para esse parágrafo? Justifique levando em conta as informações dos gráficos e do enunciado.

GABARITO.

QUESTÃO 05
(UNICAMP 2019) O abacateiro é originário do México e da América Central, sendo uma das plantas mais produtivas por unidade de área de cultivo. Nas diferentes variedades encontradas no Brasil, os frutos têm composição bem variada.

A tabela abaixo mostra alguns atributos dos frutos de duas diferentes espécies (informações relativas a 100 g de polpa). A energia a que se refere a tabela, popularmente conhecida como conteúdo (valor) energético, corresponde à energia de metabolismo dos ingredientes presentes na polpa do abacate.


a) Levando em conta a tabela, calcule os valores de energias associadas a carboidratos e a lipídios em kJ por grama, considerando que as energias correspondentes a proteínas e a carboidratos são aproximadamente iguais. Apresente seus cálculos.

b) Uma antiga receita de sabão de abacate propõe, entre outros ingredientes e procedimentos, o aquecimento da polpa da fruta na presença de soda cáustica (NaOH). Levando em conta as informações dadas, escolha um dos componentes presentes no abacate que leve à formação do produto desejado e escreva a equação química correspondente, empregando a estrutura química apropriada.

Estruturas químicas dos componentes do abacate:


GABARITO.

QUESTÃO 06
(UNICAMP 2019) A reação de evolução de oxigênio (REO) e a reação de evolução de cloro (REC) são dois processos eletroquímicos de alta relevância na decomposição da água para a conversão da energia solar e na produção de insumos químicos, respectivamente. Realizar esses dois processos separadamente é um grande desafio quando se trata do uso de água do mar.

Assim começa o resumo de um estudo recente, em que pesquisadores investigaram a construção de um eletrodo para a eletrólise da água do mar em baixo valor de pH. Sabe-se que, nas condições avaliadas, o IrOx promove as duas reações (REO e REC) e é permeável a todas as espécies presentes na água do mar, ao passo que o MnOx não promove nenhuma das duas reações e é impermeável aos íons cloreto.
(Adaptado de The Journal of the American
Chemical Society, v. 140, p. 10270-10281, 2018.)

a) Do ponto de vista químico, por que utilizar a água do mar seria um desafio? E por que vencer esse desafio seria útil à sociedade?

b) Os pesquisadores foram bem sucedidos no objetivo experimental ao empregar os dois óxidos na construção do anodo para a eletrólise da água do mar. Complete os espaços em branco da figura abaixo utilizando as opções fornecidas, de forma a ilustrar corretamente o resultado obtido nesse estudo.

Completar utilizando as seguintes opções:

GABARITO.

Física

QUESTÃO 07
(UNICAMP 2019) Nos cruzamentos de avenidas das grandes cidades é comum encontrarmos, além dos semáforos tradicionais de controle de tráfego de carros, semáforos de fluxo de pedestres, com cronômetros digitais que marcam o tempo para a travessia na faixa de pedestres.

a) No instante em que o semáforo de pedestres se torna verde e o cronômetro inicia a contagem regressiva, uma pessoa encontra-se a uma distância d = 20 m do ponto de início da faixa de pedestres, caminhando a uma velocidade inicial v0 = 0,5 m/s . Sabendo que ela inicia a travessia da avenida com velocidade v = 1,5 m/s , calcule a sua aceleração constante no seu deslocamento em linha reta até o início da faixa.

b) Considere agora uma pessoa que atravessa a avenida na faixa de pedestres, partindo de um lado da avenida com velocidade inicial v0 = 0,4 m/s e chegando ao outro lado com velocidade final v = 1,2 m/s. O pedestre realiza todo o percurso com aceleração constante em um intervalo de tempo de t = 15 s . Construa o gráfico da velocidade do pedestre em função do tempo e, a partir do gráfico, calcule a largura da avenida.

GABARITO.

QUESTÃO 08
(UNICAMP 2019) Em agosto de 2018 a Nasa lançou a Sonda Solar Parker, destinada a investigar o Sol, passando pela coroa solar. A sonda seguirá uma trajetória dando várias voltas em torno do Sol, em órbitas elípticas com grande excentricidade.

a) Considere um corpo que descreve uma órbita elíptica em torno do Sol, como ilustra a figura A. A área da elipse varrida pela linha que liga o corpo ao Sol no trecho 2 é o dobro da área varrida no trecho 1 (A2 = 2 x A1); já as distâncias percorridas nos trechos são tais que d2 = 0,8 x d1. Se a velocidade escalar média do corpo no trecho 1 é igual a V1 = 172.000 km/h, quanto vale a velocidade escalar média no trecho 2?


b) A sonda terá sua velocidade modificada (sem consumo adicional de combustível) nas passagens próximas ao planeta Vênus, explorando o efeito conhecido como catapulta gravitacional. Para ilustrar esse efeito, considere dois corpos de massas M e m, inicialmente com velocidades de mesmo módulo (V0), mesma direção e sentidos contrários.

Após a aproximação, os corpos se afastam com velocidades de módulos VA e VB, seguindo na mesma direção inicial, conforme mostra a figura B. Como a energia cinética se conserva, a velocidade de afastamento dos corpos é igual à de aproximação: 2V0 = VBVA. Encontre a velocidade VB da massa m em termos de M, m e V0. Em seguida, use M = 100m e encontre a razão VB / V0.


GABARITO.

QUESTÃO 09
(UNICAMP 2019) Nas proximidades do Sol, a Sonda Solar Parker estará exposta a altas intensidades de radiação e a altas temperaturas.

Diversos dispositivos serão usados para evitar o aquecimento excessivo dos equipamentos a bordo da sonda, entre eles um sistema de refrigeração. Um refrigerador opera através da execução de ciclos termodinâmicos.

a) Considere o ciclo termodinâmico representado abaixo para um gás ideal, em que V2 = 1,5 V1 e T1 = 200 K. Calcule a temperatura T3.

b) A partir do gráfico, estime o módulo do trabalho realizado sobre o gás em um ciclo, em termos apenas de V1, V2, P1, e P4.


GABARITO.

QUESTÃO 10
(UNICAMP 2019) A levitação acústica consiste no emprego de ondas acústicas para exercer força sobre objetos e com isso mantê-los suspensos no ar, como a formiga representada na figura A, ou movimentá-los de forma controlada.

Uma das técnicas utilizadas baseia-se na formação de ondas acústicas estacionárias entre duas placas, como ilustra a figura B, que mostra a amplitude da pressão em função da posição vertical.

a) As frequências de ressonância acústica entre duas placas, ou num tubo fechado nas duas extremidades, são dadas por, sendo L a distância entre as placas, v = 340 m/s a velocidade do som no ar, e n um número inteiro positivo e não nulo que designa o modo. Qual é a frequência do modo ilustrado na figura B?


b) A força acústica aplicada numa pequena esfera aponta sempre na direção z e no sentido do nó de pressão mais próximo. Nas proximidades de cada nó, a força acústica pode ser aproximada por Fac = −k∆z, sendo k uma constante e ∆Z = Z − Z.

Ou seja, a força aponta para cima (positiva) quando a esfera está abaixo do nó (∆z negativo), e vice-versa. Se k = 6,0 × 10ˉ² N/m e uma esfera de massa m = 1,5 × 10ˉ⁶ kg é solta a partir do repouso na posição de um nó, qual será a menor distância percorrida pela esfera até que ela volte a ficar instantaneamente em repouso? Despreze o atrito viscoso da esfera com o ar.

GABARITO.

QUESTÃO 11
(UNICAMP 2019) Capacitores são componentes de circuitos elétricos que têm a função de armazenar carga. O tempo necessário para carregar ou descarregar um capacitor depende da sua capacitância C, bem como das características dos outros componentes a que ele está ligado no circuito. É a relativa demora na descarga dos capacitores que faz com que o desligamento de certos eletrodomésticos não seja instantâneo.


O circuito da figura A apresenta um capacitor de capacitâncialigado a dois resistores de resistências RA = 40kΩ e RB = 60 kΩ, e a uma bateria de força eletromotriz ε = 12 V. A chave S é ligada no instante t = 0 e o gráfico da figura B mostra a carga q(t) no capacitor em função do tempo.


a) Qual é a diferença de potencial no capacitor em t = 0,2 s?

b) Num outro instante, a corrente no capacitor é iC = 150 µA. Quanto vale a corrente iB no resistor RB nesse instante?

GABARITO.

QUESTÃO 12
(UNICAMP 2019)
a) Todos os corpos emitem radiação, e quanto maior a temperatura do corpo, maior a potência por ele radiada. Idealmente, os corpos que têm a capacidade de absorver toda a radiação que recebem são também os melhores emissores de radiação. Esses corpos são chamados de corpos negros e apresentam espectros de emissão de radiação que dependem somente de suas temperaturas. Além disso, o comprimento de onda de máxima radiação relaciona-se com a temperatura do corpo da seguinte forma:

O Sol tem um espectro de emissão similar ao espectro do corpo negro mostrado na figura A. Os valores de emitância estão divididos pelo valor máximo; já a escala de comprimentos de onda está em nanômetros (1,0 nm = 1,0 x 10ˉ⁹ m). Quanto vale a temperatura do corpo negro?


b) A separação da radiação luminosa nos diferentes comprimentos de onda é usualmente feita pelo emprego de uma grade de difração ou de um prisma. Quando um feixe luminoso incide numa das faces de um prisma, parte dele é refletida, e outra parte é refratada. Considere que o feixe luminoso, composto das cores azul e vermelha, incide na face do prisma conforme mostra a figura B. Trace os raios refletidos e os raios refratados na primeira face do prisma, lembrando que o índice de refração depende do comprimento de onda.
Biologia

QUESTÃO 13
(UNICAMP 2019) Em 2017, um grupo de astrônomos europeus detectou sete planetas orbitando uma estrela da Via Láctea denominada TRAPPIST-1. Reproduzimos abaixo algumas informações extraídas desse estudo. As estimativas das massas dos seis planetas mais próximos da estrela sugerem fortemente uma composição rochosa.

Em especial, três planetas têm irradiações estelares* muito próximas das de Vênus, Terra e Marte. Supondo condições atmosféricas semelhantes às da Terra, deduziu-se que um desses três planetas, denominado TRAPPIST-1f, pode ter oceanos de água em forma líquida na superfície.

* irradiação estelar é a potência de energia recebida da estrela por unidade de área do planeta.

Responda às questões a seguir.

a) O estudo sugere que o planeta TRAPPIST-1f pode ter sido palco do surgimento de formas de vida semelhantes às da Terra. Levando em conta apenas as características encontradas atualmente em todos os organismos vivos, explique a importância de duas características físicas ou químicas presentes no planeta TRAPPIST-1f para a biologia dos organismos vivos como nós os conhecemos.

b) Uma teoria altamente controversa, denominada panspermia, sugere que a vida existe em vários lugares do Universo e pode ter-se disseminado entre planetas e sistemas estelares, carregada por meteoros. Considerando plausível tal teoria, se dois planetas com características semelhantes fossem semeados simultaneamente pelos mesmos micro-organismos, não necessariamente possuiriam as mesmas formas de vida bilhões de anos depois. Explique por que, incluindo em sua resposta pelo menos um fator que leva a evolução biológica a ser imprevisível.

Qual a relação entre mutações e variabilidade genética, condição essencial para a evolução biológica?

(Fonte: Michael Gillon e outros, Seven
temperate terrestrial planets around
the nearby ultracool dwarf star TRAPPIST-1.
Nature, Cambridge, v. 542, p. 456–460, fev. 2017.)

GABARITO.

QUESTÃO 14
(UNICAMP 2019) Nos últimos anos, foram desenvolvidos vários processos tecnológicos para a biodegradação dos plásticos PE (polietileno) e PET (polietilenotereftalato), amplamente utilizados na fabricação de embalagens. Em países desenvolvidos, apenas ¼ do total de PE produzido é reciclado; o restante é descartado em aterros sanitários ou queimado por combustão, resultando em enorme ônus ambiental.

a) Em um estudo inicial, verificou-se que lagartas vivas da mariposa Galleria mellonella são capazes de reduzir a massa de sacolas plásticas de PE. Posteriormente, lagartas dessa espécie foram maceradas para produzir um extrato líquido, que foi então depositado por 10 horas sobre um pedaço de PE. O gráfico abaixo mostra a massa restante por cm² de PE na ausência e na presença do extrato após 10 horas.

Por que os dados do gráfico confirmam que a redução da massa das sacolas plásticas causada pela presença das lagartas vivas não é resultado apenas da mastigação mecânica pelos insetos? Considerando que a taxa de degradação de PE definida no gráfico permanece constante, quantas horas seriam necessárias para uma quantidade suficiente de extrato degradar todo o pedaço de PE? Explique.


b) Mais recentemente, um grupo de pesquisadores descobriu uma bactéria encontrada em aterros sanitários no Japão, denominada Ideonella sakaiensis, capaz de fragmentar o PET em unidades menores, processo que depende de uma enzima específica, chamada PETase. Foi sugerido que o genoma da I. sakaiensis poderia ser utilizado para a criação de uma bactéria transgênica a ser empregada em processos industriais de reciclagem de resíduos plásticos. O que é transgenia? Para criar tal bactéria transgênica, que parte do genoma da I. sakaiensis seria essencial?

(Fontes: Paolo Bombelli e outros, Polyethylene bio-degradation by caterpillars of the
wax moth Galleria mellonella. Current Biology, Cambridge, v. 27, p. 
R283-R293, abr. 2017. Harry P. Austin e outros, Characterization
and engineering of a plastic-degrading aromatic polyesterase.
Proceedings of the National Academy of Sciences of the
USA, Washington, v. 115, p. E4350-E4357, maio 2018.
Esse estudo teve a participação do grupo liderado pelo
Prof. Dr. Munir Skaf, Pró-Reitor de Pesquisa da UNICAMP.)

GABARITO.

QUESTÃO 15
(UNICAMP 2019) Organismos vivos são classificados em grupos taxonômicos, que devem preferencialmente refletir as relações de parentesco evolutivo entre as espécies.

a) A tabela apresentada abaixo (parte a do espaço de resposta) contém características presentes em anelídeos, platelmintos e moluscos. Preencha corretamente todos os espaços em cinza na tabela, referentes às características listadas na primeira coluna, de acordo com as opções indicadas na segunda coluna. Atenção: há duas colunas denominadas X e Y; uma representa moluscos e a outra representa platelmintos.


b) Um dos critérios para a construção do diagrama abaixo (parte b do espaço de resposta) é o número de características compartilhadas entre pares de grupos taxonômicos. Preencha os retângulos em branco do diagrama com o nome de um dos dois grupos ― moluscos ou platelmintos. Utilize as linhas em branco para explicar o que representa esse tipo de diagrama.


GABARITO.

QUESTÃO 16
(UNICAMP 2019) Plantas são capazes de absorver nutrientes do solo pelas raízes. Em muitas espécies vegetais, as raízes são infectadas por fungos, estabelecendo uma interação entre organismos denominada micorriza.


a) Os efeitos das micorrizas sobre o crescimento vegetal podem ser avaliados a partir da figura A. Utilizando os dados fornecidos na figura, explique as consequências da micorriza para a planta. Que tipo de interação ecológica caracteriza a micorriza? Justifique, informando em sua resposta se a interação é positiva, negativa ou neutra para cada organismo envolvido.

b) O Brasil é um dos países que mais consomem fertilizantes sintéticos no mundo. Com base nas figuras A, B e C, explique por que a bioinoculação de fungos no solo pode ser uma alternativa ao uso de fertilizantes. Indique em sua explicação ao menos um efeito para as plantas e um efeito para o ambiente.
(Fonte: D. S. Hayman e outros, Plant Growth Responses
to Vesicular-Arbuscular Mycorrhiza.
VI. Effect of Light and Temperature.
The New Phytologist, Lancaster, v. 73, p. 71-80, jan. 1974.)

GABARITO.

QUESTÃO 17
(UNICAMP 2019) Os microtúbulos, parte do citoesqueleto, estão envolvidos em diversas etapas da diferenciação de neurônios, incluindo a origem e a função de seus prolongamentos celulares ― dendritos e axônios. As proteínas associadas aos microtúbulos (MAPs) têm funções essenciais nas células neuronais, podendo ser divididas em três famílias ― MAP1, MAP2 e tau.

a) Cite pelo menos dois papéis dos microtúbulos em uma célula eucariótica, diferentes daqueles mencionados acima.
As distribuições subcelulares de tau, MAP2 e um tipo de MAP1 (MAP1B) durante a diferenciação neuronal são representadas na figura abaixo. Na fase 4, qual MAP é encontrada em maior quantidade nos dendritos?


Legenda: Fase 1-2: célula precursora neural, com prolongamentos do tipo lamelipódio e futuros neuritos; Fase 3: neurônio com polaridade, com axônio e neuritos; Fase 4: neurônio maduro, com dendritos formados a partir dos neuritos e axônio ramificado. Os gráficos de barras representam a quantidade das MAPs, conforme legenda no painel C.

(Fonte: L. Penazzi e outros, Chapter Three - Microtubule Dynamics
in Neuronal Development, Plasticity, and Neurodegeneration. International Review of
Cell and Molecular Biology, Kidlington, v. 321, p. 89–169, 2016.)

b) Qual é a principal função dos axônios?
Plasticidade neuronal é a capacidade do sistema nervoso de se modificar estrutural e funcionalmente ao longo de seu desenvolvimento, ou quando sujeito a novas experiências. De que forma os dendritos e os axônios participam ativamente desse processo?

GABARITO.

QUESTÃO 18
(UNICAMP 2019) Recentemente, foi criado um sistema que emprega moléculas sintéticas de DNA para armazenar dados de textos, imagens ou vídeos simples. Nesse sistema, qualquer trecho compreendido entre 5 bases A na sequência da molécula sintética de DNA é chamado códex, o qual tem a estrutura genérica abaixo.


A primeira base de cada códex é o pixet, que indica qual das três linhas de pixels da imagem o códex representa: G indica a primeira linha (1), C indica a segunda linha (2) e T indica a terceira linha (3). Após o pixet, o códex inclui 19 conjuntos de duas bases (dupletos), nomeados de a até s; cada dupleto representa um pixel / gráfico na imagem.

Por exemplo, a imagem abaixo foi codificada pela sequência de DNA a seguir (apenas a sequência de uma das fitas de DNA é apresentada): AAAAACTTTATTTTCCTTTTTTACACTTGGTTTTGTGTTTGGTTAAAAATCCTTTGTTAGCCTTCCTTTTTTCATTTTGTGTTTAGAGAAAAAGTTTATTTTCGTTTTTCGCGCTCGCCGTTCGCGTTGCCGAAAAA.


a) Qual a sequência de bases do dupleto que representa os pixels do tipo? Explique, em termos da deterioração da imagem, por que a inserção de uma base extra logo após o primeiro dupleto de um códex da sequência de DNA acima é mais grave que a deleção do último dupleto desse códex.

b) Compare o funcionamento dos dupletos do sistema descrito acima com o funcionamento dos códons na codificação de aminoácidos em organismos vivos. Qual organela catalisa o processo de tradução?

GABARITO.

Prova UNICAMP 2019 (2ª fase - 3° dia) com Gabarito e Resolução Prova UNICAMP 2019 (2ª fase - 3° dia) com Gabarito e Resolução Reviewed by Redação on janeiro 21, 2019 Rating: 5

Nenhum comentário:

Tecnologia do Blogger.